mRNA expression
Gene:
DDX53 (official gene symbol)Other symbol:
DDX53CT family:
CT26CT identifier:
CT26Aliases from NCBI:
CAGEGene expression pattern ? : Testis-restricted
High-throughput data (expression in cancer samples)
SAGE(short, 10 nt tags) Show
SAGE(long, 17 nt tags) Show
MPSS (short, 13 nt tags) Show
EST Show
Validation by Ludwig Institute of Cancer Research of mRNA expression in normal tissues and cell lines (RT-PCR)
Show![]() | ||
![]() | ||
The figures shown in this section represent a standardized analysis of all reported CT-antigens in the same set of mRNA preparations from
normal human tissues and a selection of human cancer cell lines. The analysis was done by RT-PCR using the primer pairs indicated for each gene.
A total of 1.0 �g of RNA was reverse-transcribed into cDNA using the Omniscript RT kit (Qiagen, Valencia, CA) using oligo (dT)18 primers
(Invitrogen, Carlsbad, CA). JumpStart REDTaq� ReadyMix-(Sigma Aldrich, St. Louis,MO) was used for amplification according to the manufacturer's
instructions. Samples were amplified with a precycling hold at 95oC for 3 min, followed by 35 specific cycles of denaturation at 95oC
for 15 seconds,annealing for 30 seconds (10 cycles at 60oC, 10 cycles at 58oC and 15 cycles at 56oC) and extension at 72oC for 30 seconds followed by a final
extension step at 72oC for 7 minutes. The RT-PCR products were run on 1.5% agarose gels and stained by ethidium bromide. |
Published data of mRNA expression in normal tissues
ShowTissue | Methodology | PMID |
---|---|---|
Testis | RT-PCR | 14738373 |
Pancreas | RT-PCR | 14738373 |
Leukocytes | RT-PCR | 14738373 |
Brain | RT-PCR | 14738373 |
Testis | RT-PCR | 11922625 |
Testis |
RT-PCR 32cycles
5�AGGAAGGCGTGTTGAGTAGCC 3� 5�GAACTCCGCAGAGACAGGTG 3� 30cycles 5�CTTCCAACCGTATGTAGGCGAG 3� 5�CTCCTTGCGTCTTTGTCCAGGT 3� | 12531476 |
Testis | RT-PCR | 15897597 |
Testis | RT-PCR | 20726502 |
Published data of mRNA expression in neoplasias
Brain cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Glioma |
57/ 63 (90%) | qRT-PCR | 16761424 | |
Meningioma |
4/ 35 (11%) | qRT-PCR |
Gastric cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Gastrict carcinoma |
17/19 (89%) | RT-PCR | 11922625 | |
Gastrict carcinoma |
15/22 (68%) | RT-PCR | 12531476 |
Gynecological cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Cervical carcinoma |
20/20 (100%) | RT-PCR | 11922625 | |
Cervical carcinoma |
19/20 (95%) | RT-PCR | 12531476 | |
Endometrial carcinoma |
7/10 (70%) | RT-PCR | 15897597 |
Lung cancer Show
Published data of mRNA expression in Cell Lines
ShowOrigin tissue | Cell Line ID | Frequency | Methodology | PMID |
---|---|---|---|---|
Bladder carcinoma | KU7 | 1/1 (100%) | RT-PCR | 15897597 |
Breast carcinoma | MDA232 | 1/1 (100%) | RT-PCR | 15897597 |
Breast carcinoma | MDA232 | 1/1 (100%) | RT-PCR | 15897597 |
Cervical carcinoma | C33A | 1/1 (100%) | RT-PCR | 12849980 |
Endometrial carcinoma | Hec-1b Ishikawa |
2/3 (66%) | RT-PCR | 15897597 |
Gastrict carcinoma | SNU16 SNU484 SNU719 |
3/3 (100%) | RT-PCR | 12849980 |
Gastrict carcinoma | SNU5 MKN74 SNU620 SNU638 SNU719 MKN1 AGS SNU484 |
8/9 (89%) | RT-PCR | 12531476 |
Leukemia | K562 | 1/3 (33%) | RT-PCR | 15897597 |
Leukemia | K562 | 1/3 (33%) | RT-PCR | 15897597 |
Lung carcinoma | H145 H246 H526 H358 H647 H1299 H1703 |
7/7 (100%) | RT-PCR | 12531476 |
Lung carcinoma | RERF-LC-MA | 1/3 (33%) | RT-PCR | 15897597 |
Lymphoma (Diffuse large B-cell lymphoma) | OCI-Ly3 OCI-Ly10 HLY-1 SU-DHL-6 DB MIEU SU-DHL-4 |
7/9 (78%) | RT-PCR | 20726502 |
Melanoma | 888-mel A375-mel Groves-mel 501-mel |
4/7 (57%) | RT-PCR | 15897597 |
Pancreatic carcinoma | PK59 | 1/1 (100%) | RT-PCR | 15897597 |
Renal carcinoma | Satio RCC6 |
2/4 (50%) | RT-PCR | 15897597 |
2005-2009© CT Antigens Database