mRNA expression
Gene:
SSX4 (official gene symbol)Other symbol:
SSX4CT family:
CT5CT identifier:
CT5.4Aliases from NCBI:
MGC119056 , MGC12411Unified entry for genes SSX4, SSX4B (nearly-identical copies)
Gene expression pattern ? : Testis-selective
High-throughput data (expression in cancer samples)
SAGE(short, 10 nt tags) Show
SAGE(long, 17 nt tags) Show
MPSS (short, 13 nt tags) Show
EST Show
Validation by Ludwig Institute of Cancer Research of mRNA expression in normal tissues and cell lines (RT-PCR)
Show
The figures shown in this section represent a standardized analysis of all reported CT-antigens in the same set of mRNA preparations from
normal human tissues and a selection of human cancer cell lines. The analysis was done by RT-PCR using the primer pairs indicated for each gene.
A total of 1.0 �g of RNA was reverse-transcribed into cDNA using the Omniscript RT kit (Qiagen, Valencia, CA) using oligo (dT)18 primers
(Invitrogen, Carlsbad, CA). JumpStart REDTaq� ReadyMix-(Sigma Aldrich, St. Louis,MO) was used for amplification according to the manufacturer's
instructions. Samples were amplified with a precycling hold at 95oC for 3 min, followed by 35 specific cycles of denaturation at 95oC
for 15 seconds,annealing for 30 seconds (10 cycles at 60oC, 10 cycles at 58oC and 15 cycles at 56oC) and extension at 72oC for 30 seconds followed by a final
extension step at 72oC for 7 minutes. The RT-PCR products were run on 1.5% agarose gels and stained by ethidium bromide. |
Published data of mRNA expression in normal tissues
ShowTissue | Methodology | PMID |
---|---|---|
Testis |
RT-PCR 35cycles
5�AAATCGTCTATGTGTATATGAAGCT 3� 5�GGGTCGCTGATCTCTTCATAAAC 3� 3cycles 5�AAATCGTCTATGTGTATATGAAGCT 3� 5�GGGTCGCTGATCTCTTCATAA 3� | 9378559 |
Testis | RT-PCR | 11051238 |
Testis | RT-PCR | 17320278 |
Published data of mRNA expression in neoplasias
Hematologic malignacies Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Myeloma |
11/55 (20%) | RT-PCR | 17023585 | |
Monoclonal gammopathy of undetermined significance (MGUS) |
43/114 (38%) | Nested RT-PCR | 16224274 | |
Myeloma |
9/45 (20%) | Nested RT-PCR | ||
Adult T-cell leukemia/lymphoma (ATLL) |
0/33 (0%) | RT-PCR | 22323448 |
Brain cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Astrocytoma |
10/38 (26%) | RT-PCR | 11051238 | |
Meningioma |
0/37 (0%) | RT-PCR | ||
Oligoastrocytoma |
3/4 (75%) | RT-PCR | ||
Pilocytic astrocytoma |
2/5 (40%) | RT-PCR | ||
Glioma |
3/31 (10%) | RT-PCR | 9639388 | |
Glioma |
0/30 (0%) | RT-PCR | 18240144 | |
Glioblastoma |
0/7 (0%) | RT-PCR | 19096642 | |
Meningioma |
1/26 (4%) | RT-PCR | ||
Schwanoma |
0/6 (0%) | RT-PCR |
Head & Neck cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Squamous cell carcinoma |
Primary tumor | 18/57 (31%) | RT-PCR | 20715104 |
Hepatobiliary cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Hepatocellular carcinoma |
21/43 (49%) | RT-PCR | 15723723 | |
Hepatocellular carcinoma |
2/21 (9%) | RT-PCR | 12747756 | |
Hepatocellular carcinoma |
22/30 (73%) | Nested RT-PCR | 11179834 |
Lung cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Non small cell lung carcinoma |
16/42 (38%) | RT-PCR | 14512184 | |
Small cell lung carcinoma |
0/4 (0%) | RT-PCR |
Melanocytic lesion Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Melanoma |
10/37 (27%) | RT-PCR | 11051238 | |
Melanoma |
10/37 (27%) | RT-PCR | 9639388 |
Ovarian cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Ovarian carcinoma |
5/40 (12%) | RT-PCR | 15603546 | |
Ovarian carcinoma |
19/120 (16%) | RT-PCR | 16428478 | |
Ovarian carcinoma |
6/12 (50%) | RT-PCR | 11051238 | |
Ovarian carcinoma |
6/12 (50%) | RT-PCR | 9639388 |
Sarcoma Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Synovial sarcoma |
1/4 (25%) | RT-PCR | 9639388 |
Published data of mRNA expression in Cell Lines
Show2005-2009© CT Antigens Database