mRNA expression
Gene:
MAGEA3 (official gene symbol)Other symbol:
MAGEA3CT family:
CT1CT identifier:
CT1.3Aliases from NCBI:
HIP8 , HYPD , MAGE3 , MGC14613Gene expression pattern ? : Testis-selective
High-throughput data (expression in cancer samples)
SAGE(short, 10 nt tags) Show
SAGE(long, 17 nt tags) Show
MPSS (short, 13 nt tags) Show
EST Show
Validation by Ludwig Institute of Cancer Research of mRNA expression in normal tissues and cell lines (RT-PCR)
Show![]() | ||
![]() | ||
The figures shown in this section represent a standardized analysis of all reported CT-antigens in the same set of mRNA preparations from
normal human tissues and a selection of human cancer cell lines. The analysis was done by RT-PCR using the primer pairs indicated for each gene.
A total of 1.0 �g of RNA was reverse-transcribed into cDNA using the Omniscript RT kit (Qiagen, Valencia, CA) using oligo (dT)18 primers
(Invitrogen, Carlsbad, CA). JumpStart REDTaq� ReadyMix-(Sigma Aldrich, St. Louis,MO) was used for amplification according to the manufacturer's
instructions. Samples were amplified with a precycling hold at 95oC for 3 min, followed by 35 specific cycles of denaturation at 95oC
for 15 seconds,annealing for 30 seconds (10 cycles at 60oC, 10 cycles at 58oC and 15 cycles at 56oC) and extension at 72oC for 30 seconds followed by a final
extension step at 72oC for 7 minutes. The RT-PCR products were run on 1.5% agarose gels and stained by ethidium bromide. |
Published data of mRNA expression in normal tissues
ShowTissue | Methodology | PMID |
---|---|---|
Testis | RT-PCR | 8113684 |
Testis | Oligonucleotide microarray | 11751535 |
Testis | RT-PCR | 10197872 |
Testis |
RT-PCR 35cycles
5 ' TGGAGGACCAGAGGCCCCC 3� 5' GGACGATTATCAGGAGGCCTGC 3� 35cycles 5�-AAGTAGGACCCGAGGCACTG-3� 5�-GAAGAGGAAGAAGCGGTCTG-3� | 7927540 |
Placenta | RT-PCR | 7927540 |
Fetal keratinocytes | qRT-PCR | 17993289 |
Keratinocytes | qRT-PCR | 17993289 |
Published data of mRNA expression in neoplasias
Hematologic malignacies Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Myeloma |
47/91 (52%) | RT-PCR | 19190130 | |
Acute myeloid leukemia |
23/40 (57%) | RT-PCR | 21804405 | |
Adult T-cell leukemia/lymphoma (ATLL) |
18/57 (32%) | RT-PCR | 22323448 |
Bladder cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Transitional cell carcinoma |
60/102 (59%) | RT-PCR | 21396841 | |
Urothelial carcinoma |
150/350 (43%) | qRT-PCR | 22596240 |
Brain cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Astrocytoma |
2/27 (7.4%) | RT-PCR | 11051238 | |
Meningioma |
0/6 (0%) | RT-PCR | ||
Oligoastrocytoma |
0/4 (0%) | RT-PCR | ||
Oligodendroglioma |
0/3 (0%) | RT-PCR | ||
Pilocytic astrocytoma |
0/1 (0%) | RT-PCR | ||
Astrocytoma |
0/3 (0%) | RT-PCR | 9176405 | |
Ependymoma |
� (50%) | RT-PCR | ||
Glioblastoma |
7/21 (33%) | RT-PCR | ||
Meningioma |
1/3 (33%) | RT-PCR | ||
Oligodendroglioma |
0/1 (0%) | RT-PCR | ||
Medulloblastoma (Pediatric) |
2/11 (18%) | qRT-PCR | 18398575 | |
Glioma |
0/30 (0%) | RT-PCR | 18240144 | |
Medulloblastomas |
14/25 (56%) | RT-PCR | 18426187 | |
Glioma |
10/45 (22%) | RT-PCR | 22534618 | |
Meningioma |
0/26 (0%) | RT-PCR |
Colon & Rectum cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Adenocarcinoma of the large intestine |
23/82 (28%) | qRT-PCR | 23390371 |
Esophageal cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Squamous cell carcinoma |
15/20 (75%) | qRT-PCR | 19813699 | |
Esophageal carcinoma |
6/19 (32%) | qRT-PCR | 19610063 |
Head & Neck cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Squamous cell carcinoma |
14/26 (54%) | qRT-PCR | 19610063 | |
Squamous cell carcinoma |
Primary tumor | 29/57 (51%) | RT-PCR | 20715104 |
Hepatobiliary cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Hepatocellular carcinoma |
2/10 (20%)(Well differentiated) | RT-PCR | 10782910 | |
Hepatocellular carcinoma |
� (50%)(Poorly differentiated) | RT-PCR | ||
Hepatocellular carcinoma |
9/20 (45%)(Mod differentiated) | RT-PCR | ||
Hepatocellular carcinoma |
1/1 (100%)(Mixed) | RT-PCR | ||
Hepatocellular carcinoma |
35/73 (47.9%) | RT-PCR | 15723723 | |
Intraepithelial cholangiocarcinoma |
4/20 (20%) | RT-PCR | 15466353 | |
Hepatocellular carcinoma |
5/21 (24%) | RT-PCR | 12747756 | |
Hepatocellular carcinoma |
11/26(42%) | RT-PCR | 10576668 | |
Hepatocellular carcinoma |
14/22 (65%) | RT-PCR | 10189127 | |
Hepatocellular carcinoma |
21/50 (42%) | RT-PCR | 10220740 | |
Hepatocellular carcinoma |
0/4 (0%)(Well differentiated) | RT-PCR | 10568832 | |
Hepatocellular carcinoma |
15/56 (27%)(Mod or poorly differentiated) | RT-PCR | ||
Hepatocellular carcinoma |
Tumor | 16/30 (53%) | RT-PCR | 11857021 |
Hepatocellular carcinoma |
Blood sample | 10/30 (33.3%) | RT-PCR | |
Biliary tract carcinoma |
7/32 (22%) | RT-PCR | 10873083 | |
Hepatocellular carcinoma |
21/47 (45%) | RT-PCR | 15059354 |
Lung cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Non small cell lung carcinoma |
16/46 (35%) | RT-PCR | 15201976 | |
Adenocarcinoma |
6/22 (27%) | RT-PCR | 14512184 | |
Adenosquamous carcinoma |
0/1 (0%) | RT-PCR | ||
Large cell carcinoma |
2/6 (33%) | RT-PCR | ||
Small cell lung carcinoma |
3/ 4 (75%) | RT-PCR | ||
Squamous cell carcinoma |
8/13 (62%) | RT-PCR | ||
Adenocarcinoma |
7/37 (19%) | RT-PCR | 16353146 | |
Adenosquamous carcinoma |
2/3 (75%) | RT-PCR | ||
Large cell carcinoma |
4/9 (44%) | RT-PCR | ||
Squamous cell carcinoma |
16/41 (39%) | RT-PCR | ||
Undifferentiated lung carcinoma |
4/12 (33%) | RT-PCR | ||
Non small cell lung carcinoma |
20/33 (60%) | RT-PCR | 10704737 | |
Adenocarcinoma |
100/219 (46%) | RT-PCR | 16299236 | |
Bronchioloalveolar / adenobronchioloalveolar carcinoma |
40/95 (43%) | RT-PCR | ||
Squamous cell carcinoma |
77/96 (80%) | RT-PCR | ||
Non small cell lung carcinoma |
9/33 (27%) | qRT-PCR | 17066423 | |
Adenocarcinoma |
10/35 (28%) | RT-PCR | 7622303 | |
Small cell lung carcinoma |
0/3 (0%) | RT-PCR | ||
Squamous cell carcinoma |
10/14 (71%) | RT-PCR | ||
Lung carcinoma |
5/12 (42%) | Nested RT-PCR | 12133624 | |
Adenocarcinoma |
7/18 (39%) | RT-PCR | 8119772 | |
Large cell carcinoma |
0/2 (0%) | RT-PCR | ||
Small cell lung carcinoma |
2/3 (33%) | RT-PCR | ||
Squamous cell carcinoma |
7/26 (27%) | RT-PCR | ||
Adenocarcinoma |
10/27 (37%) | RT-PCR | 9486785 | |
Adenosquamous carcinoma |
0/2 (0%) | RT-PCR | ||
Small cell lung carcinoma |
0/1 (0%) | RT-PCR | ||
Non small cell lung carcinoma |
Primary tumor | 17/20 (85%) | RT-PCR | 11691819 |
Non small cell lung carcinoma |
Bronchial brush specimens from former smokers | 10/20 (50%) | RT-PCR | |
Non small cell lung carcinoma |
Adjacent normal tissue | 15/20 (75%) | RT-PCR | |
Non small cell lung carcinoma |
31/105 (29.5%)(stage I) | RT-PCR | 14690745 | |
Non small cell lung carcinoma |
49/99 (49.5%)(stage II) | RT-PCR | ||
Non small cell lung carcinoma |
57/239 (24%) | RT-PCR | 19545928 | |
Lung carcinoma |
11/20 (55%) | qRT-PCR | 19610063 | |
Adenocarcinoma |
4/29 (14%) | RT-PCR | 22138038 | |
Squamous cell carcinoma |
5/29 (17%) | RT-PCR | ||
Non small cell lung carcinoma |
34/136 (25%) | RT-PCR | 23645764 |
Melanocytic lesion Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Melanoma |
9/16 (56%) | RT-PCR | 9650552 | |
Melanoma |
5/10 (50%) | Nested RT-PCR | 12190937 | |
Melanoma |
4/5 (80%) | RT-PCR | 14634146 | |
Melanoma |
72/105 (69%) | RT-PCR | 8113684 | |
"In situ" melanoma |
0/3 (0%) | RT-PCR | 10215777 | |
Benign melanocytic nevus |
0/10 (0%) | RT-PCR | ||
Dysplastic nevus |
0/14 (0%) | RT-PCR | ||
Melanoma |
Metastatic tumor | 2/3 (67%) | RT-PCR | |
Melanoma |
Primary tumor | � (25%) | RT-PCR | |
Benign nevocellular nevus |
0/12 (0%) | RT-PCR | 7591235 | |
Dysplastic nevus |
0/4 (0%) | RT-PCR | ||
Lentigo maligna |
0/4 (0%) | RT-PCR | ||
Melanoma |
Metastatic tumor | 110/145 (76%) | RT-PCR | |
Melanoma |
Primary tumor | 36/100 (36%) | RT-PCR | |
Ocular melanoma |
Primary tumor | 1/1 (100%) | RT-PCR | 9247253 |
Ocular melanoma |
Metastatic tumor | 1/1 (100%) | RT-PCR | |
Melanoma |
7/12 (58%) | RT-PCR | 9176405 | |
Melanoma |
12/23 (52%) | RT-PCR | 9766577 | |
Melanoma |
18/28 (64%) | RT-PCR | 15305155 | |
Melanoma |
11/24 (46%) | RT-PCR | 11238304 | |
Melanoma |
Skin metastasis | 144/230 (63%) | RT-PCR | 15570431 |
Melanoma |
Internal organ metastasis | 17/32 (53 %) | RT-PCR | |
Melanoma |
Lymphnode metastasis | 35/54 (65%) | RT-PCR | |
Melanoma |
Blood samples from melanoma patients | 14/94 (18%) | qRT-PCR | 15817820 |
Melanoma |
Sentinel node | 25/46 (47%) | qRT-PCR | 15226334 |
Melanoma |
Primary tumor | 4/10 (40%) | RT-PCR | 10506625 |
Melanoma |
Sentinel node from melanoma patients | 12/17 (71%) | RT-PCR | |
Melanoma |
Sentinel node from melanoma free patients | 24/55 (44%) | RT-PCR | |
Melanoma |
111/202 (55%) | RT-PCR | 19326132 |
OTHER CANCER Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Neuroblastoma |
23/47 (49%) | RT-PCR | 18820946 |
Ovarian cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Mucinous ovarian carcinoma |
Peritoneal fluid | 1/5 (20%) | RT-PCR | 12115308 |
Papillary ovarian carcinoma |
Peritoneal fluid | 3/11 (27%) | RT-PCR | |
Serous-papillary ovarian carcinoma |
Peritoneal fluid | 4/11 (36%) | RT-PCR | |
Benign tumor |
0/10 (0%) | RT-PCR | 8550240 | |
Clear-cell carcinoma |
0/14 (0%) | RT-PCR | ||
Dermatoid cyst with malignant transformation |
0/12 (0%) | RT-PCR | ||
Endometrioid carcinoma |
1/15 (6%) | RT-PCR | ||
Fibrosarcoma |
1/1 (100%) | RT-PCR | ||
Granulosa cell tumor |
0/4 (0%) | RT-PCR | ||
Mucinous adenocarcinoma |
1/16 (6%) | RT-PCR | ||
Serous ovarian adenocarcinoma |
16/19 (84%) | RT-PCR | ||
Sertoli-Leydig tumor |
0/1 (0%) | RT-PCR | ||
Transitional cell carcinoma |
0/12 (0%) | RT-PCR | ||
Yolk-sac tumor |
� (25%) | RT-PCR |
Pancreatic cancer Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Adenocarcinoma |
12/12 (100%) | qRT-PCR | 22770803 |
Sarcoma Show
Tumor Subtype | Sample type | Frequency | Methodology | PMID |
---|---|---|---|---|
Osteosarcoma |
28/28 (100%) | qRT-PCR | 22009167 |
Published data of mRNA expression in Cell Lines
ShowOrigin tissue | Cell Line ID | Frequency | Methodology | PMID |
---|---|---|---|---|
Adult keratinocyte cell line | NHEK | RT-PCR | 19358718 | |
Adult T-cell leukemia/lymphoma (ATLL) | MT-4 TL-Om1 TL-Su TCL-Kan HUT102 |
5/10 (50%) | RT-PCR | 22323448 |
Breast carcinoma | SUM159 SUM52 SUM44PE SUM229 MCF7 T47D ZR-75-1 UCT-Br1 SUM185 |
9/12 (75%) | RT-PCR | 16505281 |
Breast carcinoma | HM InLa KM22 KS SkBr3 T47D ZR-7530 |
7/13 (54%) | RT-PCR | 12836015 |
Breast carcinoma | BT-20 HBL-HX Hs 578T |
RT-PCR | 8416750 | |
Colorectal carcinoma | SNU-175 SNU-283 SNU-407 SNU-769A SNU-769B SNU-1033 SNU-1047 SNU-1197 SNU-C1 SNU-C2A Caco COLO320 HCT-116 HT-29 Lovo LS174T NCI-H716 SW403 SW480 SW1116 WiDR |
21/32 (66%) | RT-PCR | 17007017 |
Colorectal carcinoma | VMRC-MELG WiDr |
2/8 (25%) | RT-PCR | 8757382 |
Gastrict carcinoma | SNU-16 SNU-216 SNU-484 SNU-719 |
4/11 (36%) | RT-PCR | 11289403 |
Glioblastoma | GL-6 T-98G |
RT-PCR | 21785609 | |
Glioma | 2/13 (15%) | RT-PCR | 22534618 | |
Head and neck squamous cell carcinoma | SCC-4 SCC-90 PCI-13 PCI-30 JHU-011 JHU-012 UD-SCC-6 |
7/7 (100%) | qRT-PCR | 19610063 |
Hepatocellular carcinoma | QQY-7701 | 1/3 (33%) | RT-PCR | 14607688 |
Leukemia | HL60 P39 |
2/4 (50%) | RT-PCR | 12399967 |
Leukemia | K562 TF1 HL60 |
3/16 (19%) | RT-PCR | 11681419 |
Lung carcinoma | H209 H345 H510 LB11 LB37 |
RT-PCR | 1840703 | |
Lung carcinoma- NSCLC | H-596 H-1650 H-2087 H-2228 |
4/4 (100%) | qRT-PCR | 11216765 |
Lung carcinoma- NSCLC | UKY-29 NCI-H1650 NCI-H1466 NCI-H2023 NCI-H2405 NCI-H322 NCI-H647 NCI-H838 NCI-H1155 NCI-H1264 NCI-H1693 NCI-H944 |
RT-PCR | 11551413 | |
Melanoma | MZ2-MEL3.0 LB373-MEL SK-MEL-23 |
3/3 (100%) | qRT-PCR | 15153480 |
Melanoma | Sk-Mel-37 Sk-Mel-29 Sk-Mel-28 Sk-Mel-24 Malme-3M |
5/5 (100%) | RT-PCR | 18395366 |
Melanoma | MZ2.MEL3.0 LB34-MEL M110221-MEL M113443-MEL SK33-MEL SK23-MEL LB17-MEL LB33-MEL MI4024-MEL MZ3-MEL MZ5-MEL |
RT-PCR | 1840703 | |
Melanoma | LB1751-MEL LB373-MEL AVL3-MEL MZ2-MEL.3.0 LB1448-MEL.2 LB1781-MEL |
6/9 (67%) | Oligonucleotide microarray | 11751535 |
Melanoma | WM115-A WM1972-A WM1976-A WM3130-A |
4/4 (100%) | RT-PCR | 18205182 |
Melanoma | UKRV-Mel-02 WM98.1 UKRV-Mel-14 UKRV-Mel-06 UKRV-Mel-21 UKRV-Mel-31 UKRV-Mel-27 Ma-Mel-13 SK-Mel-23 |
9/24 (38%) | Nested RT-PCR | 12190937 |
Melanoma | 397-mel 397-R4-mel 501-mel 526-mel 537-mel 553-mel 586-mel 624-mel 677-mel 697-mel 836-mel 938-mel MZ2-mel.43 SK23-mel YU-SIT-I |
15/17 (88%) | RT-PCR | 8416750 |
Melanoma | MZ2-MEL MZ2-MEL.61D LY1-MEL MI-10221-MEL LY2-MEL LY4-MEL SK23-MEL LB34-MEL NA6-MEL MI-13441-MEL LB5-MEL LB33-MEL LB73-MEL |
13/16 (81%) | RT-PCR | 8113684 |
Melanoma | Ma-Mel-13 Ma-Mel-33 UKRV-Mel-06 UKRV-Mel-10 UKRV-Mel-14 UKRV-Mel-31 |
6/15 (40%) | RT-PCR | 12932233 |
Melanoma stem cells (MSC) | WM115-NA WM1972-NA WM1976-NA WM3130-NA |
4/4 (100%) | RT-PCR | 18205182 |
Myeloma | MOLP-8 KMS-12-BM EJM IM9 RPMI-8226 NCI-H929 LP-1 U-266 Brown SK-007 |
10/11 (91%) | RT-PCR | 17023585 |
Myeloma | BCN MDN SBN XG1 JJN3 XG6 XG7 AMO-1 Karpas 620 L363 NCI-H929 0PM2 U266 |
13/17 (76%) | RT-PCR | 10741395 |
Myeloma | EJM L363 U266 |
3/3 (100%) | qRT-PCR | 15153480 |
Neuroblastoma | SK-N-MC |
RT-PCR | 21785609 | |
Nullipotent teratocarcinoma | PA-1 | RT-PCR | 21785609 | |
Oral squamous cell carcinoma | PCI13-11 PCI1-1 PCI52 PCI68-1 |
5/5 (100%) | RT-PCR | 19358718 |
Osteosarcoma | U-2OS |
RT-PCR | 21785609 | |
Ovarian carcinoma | JOHS-2 OV-90 ES-2 KURAMOCHI |
4/14 (28%) | qRT-PCR | 11985796 |
Ovarian carcinoma | ElGr FraW GG KlHe |
4/6 (33%) | RT-PCR | 12836015 |
Pancreatic adenocarcinoma | Panc-1 818.4 |
2/10 (20%) | RT-PCR | 14991579 |
Pancreatic carcinoma | AsPC BxCP CFPAC Colo-357 HPAF-II HCG-25 Hs 766T |
7/9 (78%) | RT-PCR | 10699892 |
Pluripotent stem cells | SC5 SC7 SC3a |
RT-PCR | 21785609 | |
Rhabdomyosarcoma | A204v |
RT-PCR | 21785609 | |
Rhabdomyosarcoma (embryonal) | RD | RT-PCR | 21785609 | |
Sarcoma | SK-ES1 SK-LMS1 SK-872 Saos2 MES-5� HT-1080 |
6/8 (75%) | RT-PCR | 15298487 |
Thyroid cancer | TT | RT-PCR | 1840703 |
2005-2009© CT Antigens Database